Gene Transfer from Algea to Sea Slug

February 5, 2015

The sea slug. "Elysia pusilla" by Katharina Händeler, Yvonne P. Grzymbowski, Patrick J. Krug & Heike Wägele - Händeler K., Grzymbowski Y. P., Krug P. J. & Wägele H. (2009) "Functional chloroplasts in metazoan cells - a unique evolutionary strategy in animal life". Frontiers in Zoology 6: 28. doi:10.1186/1742-9994-6-28 Figure 1F.. Licensed under CC BY 2.0 via Wikimedia Commons.

The sea slug. “Elysia pusilla” by Katharina Händeler, Yvonne P. Grzymbowski, Patrick J. Krug & Heike Wägele – Händeler K., Grzymbowski Y. P., Krug P. J. & Wägele H. (2009) “Functional chloroplasts in metazoan cells – a unique evolutionary strategy in animal life”. Frontiers in Zoology 6: 28. doi:10.1186/1742-9994-6-28 Figure 1F.. Licensed under CC BY 2.0 via Wikimedia Commons.

One of my students wanted to figure out how to make animals photosynthesize. Well, this article indicates that sea slugs have figured out how eat and digest the algae but keep the algal chloroplasts alive in their guts so the sea slug can use the fats and carbohydrates the chloroplasts produce (the stealing of the algal organelles is called kleptoplasty). To maintain the chloroplasts, the slugs have actually had to incorporate some of the algae DNA into their own chromosomes–this is called horizontal gene transfer and it’s what scientists try to do with gene therapies.

More details here.

Magnification ?.

Filamentous algae like the ones eaten by the sea slugs.

Citing this post: Urbano, L., 2015. Gene Transfer from Algea to Sea Slug, Retrieved April 27th, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

DNA Models and Games

February 20, 2014

The DNA strand in this board game splits as players end up on different paths based on their choices in the game.

The DNA strand in this board game splits as players end up on different paths based on their choices in the game.

Ms. Mertz’s class is studying DNA–replication, translation, transcription, etc.–and she gave them the option of making a model or creating a game to test each others knowledge. There were some interesting projects:

A DNA strand modeled with the bases represented by colored marshmallows. Toothpicks connect the marshmallows along the backbone of the helices, while  Twizzlers are used to show the bonding across the two DNA strands.

A DNA strand modeled with the bases represented by colored marshmallows. Toothpicks connect the marshmallows along the backbone of the helices, while Twizzlers are used to show the bonding across the two DNA strands.

The quiz questions in this board game are visible to all the players, which allows for more in-depth discussion of the answers.

The quiz questions in this board game are visible to all the players, which allows for more in-depth discussion of the answers.

Helicase (the cotton ball) splits the DNA double helix.

Helicase (the cotton ball) splits the DNA double helix.

Ms. Mertz helps a student with their research project on cloning.

Ms. Mertz helps a student with their research project on cloning.

The study of DNA and heredity offer great opportunities to study probability. In this case, a player has to traverse 80 squares by rolls of a single dice, and then answer a question from a card. If they get the wrong answer they do not advance, but if they pull a Go to Jail card they have to go back to Jail. If there are 20 cards and two of them send you back to Jail, what's the probability of anyone finishing the game?

The study of DNA and heredity offer great opportunities to study probability. In this case, a player has to traverse 80 squares by rolls of a single dice, and then answer a question from a card. If they get the wrong answer they do not advance, but if they pull a Go to Jail card they have to go back to Jail. If there are 20 cards and two of them send you back to Jail, what’s the probability of anyone finishing the game?

Citing this post: Urbano, L., 2014. DNA Models and Games, Retrieved April 27th, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

DNA Visualization

February 13, 2014

Screen capture from R.M's code.

Screen capture from R.M’s code.

Another interesting project that came out of the Creativity Interim was a VPython program that uses the DNA Writer translation table to convert text into a DNA sequence that is represented as a series of colored spheres in a helix.

The code, by R.M. with some help from myself, is below. It’s pretty rough but works.

dna_translator.py

from visual import *
import string

xaxis = curve(pos=[(0,0),(10,0)])

inp = raw_input("enter text: ")
inp = inp.upper()


t_table={}



t_table['0']="ATA"
t_table['1']="TCT"
t_table['2']="GCG"
t_table['3']="GTG"
t_table['4']="AGA"
t_table['5']="CGC"
t_table['6']="ATT"
t_table['7']="ACC"
t_table['8']="AGG"
t_table['9']="CAA"
t_table['start']="TTG"
t_table['stop']="TAA"
t_table['A']="ACT"
t_table['B']="CAT"
t_table['C']="TCA"
t_table['D']="TAC"
t_table['E']="CTA"
t_table['F']="GCT"
t_table['G']="GTC"
t_table['H']="CGT"
t_table['I']="CTG"
t_table['J']="TGC"
t_table['K']="TCG"
t_table['L']="ATC"
t_table['M']="ACA"
t_table['N']="CTC"
t_table['O']="TGT"
t_table['P']="GAG"
t_table['Q']="TAT"
t_table['R']="CAC"
t_table['S']="TGA"
t_table['T']="TAG"
t_table['U']="GAT"
t_table['V']="GTA"
t_table['W']="ATG"
t_table['X']="AGT"
t_table['Y']="GAC"
t_table['Z']="GCA"
t_table[' ']="AGC"
t_table['.']="ACG"

dna=""

for i in inp:
    
    dna=dna+t_table[i]
print dna

m=0
r=3.0
f=0.5
n=0.0
dn=1.5


start_pos = 1
for i in dna:
    rate(10)
    n+=dn
    m+=1
    x = n
    y=r*sin(f*n)
    z=r*cos(f*n)
    a=sphere(pos=(x,y,z))
    #print x, y, z
    if (i == "A"):
        a.color=color.blue
    elif (i== "G"):
        a.color=color.red
    elif (i== "C"):
        a.color=color.green

Citing this post: Urbano, L., 2014. DNA Visualization, Retrieved April 27th, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Return to 3rd Degree

May 18, 2013

Glass tile using the DNA Writer codon translation table.

Last weekend, I took the Glass Art Sampler class at the Third Degree Glass Factory, and got to try my hand at making a paperweight, a glass tile, and a few beads. It was awesome.

I’d had the chance to make a paperweight when my Lamplighter class had visited St. Louis a couple years ago, so I had a general idea of some of the possibilities. This time, however, I had DNA sequences on the brain, and went in with a bit of a theme in mind.

The tiles were the easiest because all you need to learn how to do was cut glass — by scoring it and using a little pliers like device to break it along the score — and then arrange the tiles of colored and clear glass on a tile. The arrangement was placed in a flat kiln, and then a day or so later, you tile would be all melted together. Pretty simple for a beginner.

My glass tile arrangement sitting in the kiln.

There is, of course, a bit more to it than that. The way the glass is stacked can be used to create floating effects; some colors will react when melted in the kiln to give different colors; care needs to be taken to manage where bubbles show up in the cooled glass; among other things.

Since it’s easiest to make straight edged cuts in glass, I made four sets of square colored tiles — yellow, red, blue, and green — to make a nucleotide sequence based off the DNA Writer translation table (with the start and stop codons added in).


Paperweight

I tried something similar when making the paperweight.

A blob of molten glass.

Usually, you start with a blob of molten, clear glass on the end of a metal rod, and dip it into trays of colored glass shards that stick to the molten glass. You can then pull and twist the viscous glass with a large pair of tweezers to blend the colors and make pretty patterns. The twisted glass is then pushed into a blob at the end of the rod, and the whole thing encased in more clear glass.

Twisting the glass.

Instead, I wanted to create a discernible pattern of colors to create a multi-colored helix of molten phenocryst-like blobs in the clear glass. I really wasn’t sure how to make it work. I though perhaps I could dip the initial glass blob into a pattern of shards and then pull it out once while twisting to get the spiral pattern. Our instructor was patient as I tried to explain my ultimate goal, and he came up with a more subtle method for making the spiral.

A pattern of colored glass chips.

I laid out the short pattern of colored glass shards and carefully dipped the initial blob of clear glass into it. All the shards stuck, which was good. Then instead of pulling with tweezers, the instructor helped my gently roll the blob of glass along a metal surface at a slight downward angle. Contact with the metal cooled the tip of the glass faster than rest of the blob causing the whole thing to twist just nicely. After smoothing things with a block we covered it with more clear glass (and smoothed again), and were done.

One week later:

Half a double helix encased in glass.

Working with big blobs of extremely hot glass is quite challenging, so I couldn’t replicate this on my own at the moment. I may have to take another class.

Glass Beads

The instructor melts a yellow glass rod in the flame and drops the molten glass onto a thin metal rod to create a bead.

I would feel comfortable making glass beads after the one class, but mastering the art is going to take a lot of practice. The flame — created from a mix of fuel gas (propane I think) and oxygen — is quite hot, and it takes some expertise to be able to melt the glass and twirl it onto the rods to make a nice round bead. The trickiest part, however, is making little colored dots to decorate the bead. You need to melt small bits of glass for the dots, then move the bead through the flame to warm it up enough so the dot will stick to the bead while not melting the bead too much. Then you pass the bead through the flame again to set the dot. If the bead or the dot is too cool when they’re put together the dots will pop off. I had a lot of popping dots.

I was not able to get my nucleotide sequence onto a bead in the time I had, but I did at least get to make a couple beads.

Citing this post: Urbano, L., 2013. Return to 3rd Degree, Retrieved April 27th, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Meiosis: Passing on Half of Your Genes

May 2, 2013

Now that we have an idea of what a strand of DNA looks like we’re going to start talking about how our genes are passed on to our kids.

During normal time (interphase) our DNA is stored in the nucleus of our cells. Humans have 23 pairs of chromosomes. Of each pair, one comes from your mom and one from your dad.

The 23 pairs of human chromosomes. One chromosome in each pair comes from each parent. Image from the NIH.

When a cell is not reproducing (which is most of the time) the chromosomes are unspooled threads in the cell’s nucleus.

An unspooled strand of DNA in the cell nucleus.

When the cell is preparing to reproduce, each DNA strand duplicates.

Each chromosome duplicates in preparation for cell reproduction.

Then they fold up into the chromosomes and line up in the center of the cell.

DNA folded into chromosomes in the cell nucleus. The centrioles (plastic cups) move to opposite sides of the cell nucleus.

Now this is where interesting things start to happen. In mitosis, each chromosome pairs up with its duplicate, so when these are pulled apart you get two new cells with exactly the same DNA.

Mitosis produces two identical cells. Image from the NIH.

In meiosis however, where the cell breaks apart into reproductive cells called gametes, the two parent chromosomes pair up and exchange some DNA before being pulled apart (the DNA exchange is called crossing over). Since the DNA has duplicated before this happens, when the cell splits, you end up with two new daughters with mixed up DNA. Each daughter nucleus has two chromosomes, like all your other cells, but unlike every other (non-reproductive) cell in your body those chromosomes are different because of the DNA mixing. In addition, in the last step of meiosis (called Meiosis II) each daughter cell splits apart into two more daughter cells (granddaughter cells?) each with only one chromosome.

Meiosis produces four cells (gametes), each of which has only half as many chromosomes as one of your normal cells. Image from the NIH.

Again, it’s important to note that because of the crossing over and the second splitting, when everything is done, you end up with four cells — called gametes –, each of which has its own unique DNA. And unlike the other cells in your body, which have 23 pairs of chromosomes, each gamete only has 23 chromosomes.

Because a normal cell has 23 pairs of chromosomes is called a diploid cell. The gametes with only 23 single chromosomes is called haploid. These haploid gametes are the reproductive cells — eggs and sperm.

Thus, the DNA you contribute to your kids is not the same strands that you have in your cells, but a halved mixture of the two sets of genes you got from your parents.

References

The NIH has an excellent primer called “What is a Cell” on the history of cells, their parts, and how they split.

Citing this post: Urbano, L., 2013. Meiosis: Passing on Half of Your Genes, Retrieved April 27th, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Beading DNA

April 29, 2013

A small group of students use the DNA Writer website (on an iPad) to assemble a string of beads to represent a four genes on a piece of DNA.

Meiosis is a little hard to explain and follow, even with the videos to help, so I thought I’d try a more concrete activity — making DNA strands out of beads — to let students use their hands to follow through the process.

I started them off making a simulated human with four genes. They got to choose which genes, and they went with: hair color, number of eyes, height, and eye color. Then each group picked a different version of the gene (a different allele) for their person. Ravenclaw’s, for example, had brunette hair, three eyes, was tall, and had red eyes. Using the DNA Writer translation table , which maps letters and text to codons, they were then able to write out a string of DNA bases with their person’s information. I had them include start and stop codons to demarcate each gene’s location, and put some non-coding DNA in between the genes.

Ravenclaw’s Sequence

TAGGAATTGCATCACGATCTCCTATAGTAGCTATAACTAATCCCACCG
TTGGTGTAAACTCATATATGCTATGCATTGTAGACTATCATCTAAATG
GATTCGGACCATTCGTTGCACCTATACTAATCAGCATGCATC 

Since DNA is made up entirely of only four bases (A, C, T, and G), students could string together a different colored bead for each base to make a physical representation of the DNA strand. To make this a little easier, I adapted the DNA Writer to print out a color representation of the sequences as well. Most of the students used the color bars, but a few preferred to do their beading based off the original sequence only.

Ravenclaw’s DNA sequence color coded, and translated back to English (note the start and stop codons and the non-coding DNA in between each gene.

Just the beading took about 40 minutes, but the students were remarkable focused on it. Also, based on students’ questions while I was explaining what they had to do, the beading really helped clarify the difference between genes and alleles, and how DNA works.

Ravenclaw’s bead strand.

Ravenclaw’s four genes on the DNA string annotated. Note that start and stop codons bracket each gene, and there is non-coding (junk) DNA between each gene.

Each of these DNA strands represents the half-sequence that can be found in a gamete. Next class, we’ll be using our DNA strands to simulate fertilization, mitosis and meiosis. Meiosis, should be most interesting, since it is going to require cutting and splicing the different strands (to simulate changing over), and following the different alleles as four new gametes are produced. This will, in turn, lead into our discussion of heredity.

Citing this post: Urbano, L., 2013. Beading DNA, Retrieved April 27th, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

From DNA to Proteins: A Simulation Game

March 15, 2013

Figure 1. Students assemble a molecule after translating the instruction from the gene sequence.

Abstract

This simulation was designed to have middle school students practice reading instructions (proteins) from a sequence of genetic bases (DNA) to better understand how gene translation works and learn the types of things that proteins do. The exercise and discussion lasted 55 minutes (with one preparatory homework assignment). Students appeared to have a lot of fun doing the simulation (especially because of the competition between groups) and we had an excellent discussion afterwards.

Introduction

DNA holds the instructions that control what our bodies in the pattern of molecules (nucleobases) that make up our genes. The genes are located in the nucleus of our cells (as well as for all eukaryotes). When genes are expressed, they create proteins that actually get all the work done.

The jobs of proteins can be summed up a three things:

  • some proteins build structures like muscles,
  • other proteins are enzymes that catalyze reactions, like the breakdown of food in the digestive system, and
  • other proteins are used for sending messages.

Using the DNA Writer application for converting text into simulated DNA sequences, I create an exercise for students to practice:

  • Finding simulated genes in a DNA sequence
  • translating the genetic code into an instruction (a simulated protein)
  • performing the different types of jobs that proteins do.

The simulation was modeled as a competitive game, with the class of 7th and 8th graders broken into four groups that competed against one another to see who could complete the instructions the fastest. I cheated, I’m afraid, because what I did not tell them was that, in order to complete the last instruction, the groups would all need to work together, so there would be no single group winner.

Procedure

Pre-exercise Homework

Example Homework Assignment: HW-eg.pdf

This being the first time I’ve tried anything like this, I was not sure how long it would take students to translate the DNA code to english, so a couple days before the simulation I handed out individualized homework assignments so they could practice. I chose science vocabulary words like “protein”, “ribosome”, and “amino acids” for short, simple messages.

Figure 2. This homework assignment consists of a simulated DNA sequence, the translation table, some instructions on how it works that comes from the DNA Writer app (use the printer friendly output option). The assignment can thus be individualized. This message translates as “amino acids”. Students were able to do the translation in less than five minutes. (pdf)

At least I had intended for it to be homework. As soon as they got the handout, and the 2 minute explanation about how it worked, they hashed out the messages in about five minutes.

The trickiest part was that the first few letters they translated did not make any sense, since they’re random sequences meant to represent non-coding DNA. However, once they got to the “start” codon it was pretty easy sailing.

Given how fast they were able to do the translation (and how eager and enthusiastic they were about it), I realized how unfounded were my fears that the translations would take too long for the competitive part of the exercise to work.

The Simulation/Exercise

Materials

There are only a few materials required for this lab:

  • envelopes – one for each group (size does not matter)
  • a chain of paperclips (100 seemed to work pretty well) You only need one set of 100 because the groups will be working on this together.
  • enough parts of a molecule-building kit to make a methane molecule (CH4).
  • printout of the translation table (eg. HW-eg.pdf or from DNA Writer).

Figure 3. Materials and printouts used in this activity.

Preparation

For each group

  • Write out the main set of instructions. The instruction I used were:
    • PULL APART ALL THE PAPERCLIPS
    • BUILD A METHANE MOLECULE
    • BUILD A BUTANE MOLECULE
  • I used the DNA Writer to get the code for each instruction individually then stuck them together in a text editor (like Word) (Note: it might even be better to give them a bead string with the base sequence instructions). These three instructions together looked like this:

TATTGCACATTGGAGGATATCATCAGCACTGAGACTCACT
AGAGCACTATCATCAGCTAGCGTCTAAGCGAGACTGAGCT
ACACTCAATCCTGGAGTGATAACTCTCACTAGTATAGTCG
TTGCATGATCTGATCTACAGCACTAGCACACTATAGCGTA
CTCTCCTAAGCACATGTATCCTATCAGATATCCTATAATG
TCTATGCGTATCATTGCATGATCTGATCTACAGCACTAGC
CATGATTAGACTCTCCTAAGCACATGTATCCTATCAGATA
TCCTATAAGCAATCCACGCT

  • Write or print out an address label as a DNA sequence, and stick it on to the envelope.
    • Since my groups had already named themselves, my addresses were something along the lines of, “Give to Gryffendor”.
  • Write out a message and stick it into each envelope
    • My messages were things like: “Do 10 pushups”; or “Dance Gangnam Style”.
  • Do 10 pushups.

  • Chain together the paperclips:
    • The groups will be working together to pull apart the paperclips, so you want enough paperclips so that it takes a few minutes to do. This way the slower groups will have a chance to catch up with the faster groups.
  • Put the molecule building parts in a jar – one for each group.

Procedure

So I took the class to the gym and stuck each of the four groups on a side of the basket ball court. Each group had a jar of molecule parts (only enough to build a methane molecule), an addressed letter with a message in it, and the long DNA sequence.

The paperclips were in a box in the center circle of the court.

We gathered around the center circle for instructions, which basically consisted of me telling them they had to

  • deliver their message first,
  • then do the whatever was in the message delivered to them,
  • then follow the instructions in the long DNA sequence

They were eager to go.

Results

Methane molecule assembled.

The entire thing went remarkably smoothly, which was somewhat surprising since this is the first time I’ve ever tried anything like this.

It only took 20 minutes from the time they started to when they finally put together the butane molecule.

A few small issues did come up, however.

Since they had only ever decoded a single instruction from a single DNA sequence before, almost all the groups stopped after the first instruction on the long sequence (pull apart the paperclips). I had to point out that a real DNA sequence contains a whole sequence of genes, so they probably ought to continue translating.

Another group tried doing shortcuts, and when they saw that they had parts from the molecule building kit and the instruction was, “BUILD A M”, they assumed that they were just supposed to build any molecule. I had to intervene on that one too.

Figure 4. Each group contributed one person to pulling apart the paperclip chain. Pulling apart the paperclips represents the catalytic breakdown of long polymers in food (starches and proteins for example) by enzymes.

When the person from the third group arrived to help pull apart the paperclips, the two already there complained that more people would just slow them down. I had to point out that they could just break the long chain they were working on into smaller pieces and then everyone could work and the work would go a lot faster. The breaking of the chains is supposed to represent the catalytic effect of enzymes.

One group mistakenly blocked off the first two letters in the DNA sequence instead of the first three (for a codon), and couldn’t figure out why their sequence was not telling them anything. I had to help out with that one, but in our post-simulation discussion it reminded me to talk about transcription errors and how the genetic code can change.

Finally, they were, some more than other, sorely disappointed that there would be no winner. They so wanted to win that they did not want to share their molecule parts to build the butane molecule.

Figure 4. A student holds a butane molecule model.

Discussion

When we were done with the exercise, we gathered around in the center circle to debrief. We reviewed what DNA does and the three things that proteins do:

  • Assembling the butane molecule from the methane monomers represented the use of proteins to build structures.
  • Pulling apart the paperclips represented the breakdown of food in the digestive system. Starches, for example, are long chained polymers that are broken down into their constituent sugars by enzymes in saliva and in the stomach.
  • The envelope with the message was a very literal representation of proteins as message carriers.

I actually forgot to talk about the transcription errors one group was making during our circle discussion, so we ended up talking about it on the following day. One student had remembered the video I showed earlier about gene expression that compared the rate of errors in DNA encoding compared to computer disks. The DNA coding is much more reliable, but when billions upon billions of bases are being coded then errors will still creep in.

This lead to a discussion about mutations, and how some DNA transcription errors could give messages that made no sense and would be ignored, while others could send signals that could affect the body’s functions. The latter types of mutation can be good or bad.

Conclusion

The exercise went remarkably well. Key to it, I think, was the fact that the students were able to so efficiently translate the DNA code to English. Also, the instructions were designed to feed back into things they’d done in the past, like assemble covalent molecules and polymers.

Citing this post: Urbano, L., 2013. From DNA to Proteins: A Simulation Game, Retrieved April 27th, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

DNA Writer: Storing Information in DNA Exercise

February 2, 2013

DNA Writer: Translate text into a DNA code (and back again) using a simple lookup table.

I created this little DNA Writer webpage after seeing the article on scientists recording one of Shakespeare’s sonnets on DNA, I was inspired to put together something similar as an assignment for my middle-school science class to demonstrate how DNA records information. With the website to do quick translations for me, I’ll give each student the translation table and a simple message in DNA code and have them figure out the message.

Update: I’ve adapted the code to add a two to five letter sequence of non-coding DNA to the beginning and end of the message code. There’s also start and stop code as well.

The DNA sequence (or RNA in this figure) can be broken down into groups of three nucleotides called codons. Each codon codes for a specific amino acid, so the order of codons gives the sequence of amino acids in the proteins created by the DNA strand. Image by TransControl via Wikipedia.

The DNA Writer code uses a simple look-up table where each letter in the English alphabet is assigned a unique three letter nucleotide code. The three letters are chosen from the letters of the DNA bases – AGCT – similar to the way codons are organized in mRNA. Any unknown characters or punctuation are ignored.

Also, with a little tweaking, I think I can adapt this assignment to show how random mutation can be introduced into DNA sequences during transcription. Maybe break the class into groups of 4, give the first student a message as a nucleotide sequence have them copy and pass it on to the next student and so on. If I structure this as a race between the groups, then someone’s bound to introduce some errors, so when they translate the final code back into English they should see how the random mutation affected their code.

UPDATE: Non-Coding (junk) DNA: I’ve updated the code so that you have the option of adding a short (2-5 character) string of non-coding DNA to the beginning and end of each sequence.

A more personalized and printer friendly format for output.

UPDATE 2: Personalized and Printable output: Since I’m using the DNA writer to give each student a personalized message, I’ve created a button that gives “Printer Friendly Output” which will produce an individualized page with the code, the translation table, and some information on how it works, so I can print off individualized assignments more easily.

UPDATE 3: You can now get a color coded version of the sequence.

Ravenclaw’s DNA sequence color coded, and translated back to English.

Update 4: Now you can embed the nucleobase color patterns into other websites. Like so:

Citing this post: Urbano, L., 2013. DNA Writer: Storing Information in DNA Exercise, Retrieved April 27th, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Creative Commons License
Montessori Muddle by Montessori Muddle is licensed under a Creative Commons Attribution-Noncommercial-Share Alike 3.0 United States License.