DNA Visualization

February 13, 2014

Screen capture from R.M's code.

Screen capture from R.M’s code.

Another interesting project that came out of the Creativity Interim was a VPython program that uses the DNA Writer translation table to convert text into a DNA sequence that is represented as a series of colored spheres in a helix.

The code, by R.M. with some help from myself, is below. It’s pretty rough but works.

dna_translator.py

from visual import *
import string

xaxis = curve(pos=[(0,0),(10,0)])

inp = raw_input("enter text: ")
inp = inp.upper()


t_table={}



t_table['0']="ATA"
t_table['1']="TCT"
t_table['2']="GCG"
t_table['3']="GTG"
t_table['4']="AGA"
t_table['5']="CGC"
t_table['6']="ATT"
t_table['7']="ACC"
t_table['8']="AGG"
t_table['9']="CAA"
t_table['start']="TTG"
t_table['stop']="TAA"
t_table['A']="ACT"
t_table['B']="CAT"
t_table['C']="TCA"
t_table['D']="TAC"
t_table['E']="CTA"
t_table['F']="GCT"
t_table['G']="GTC"
t_table['H']="CGT"
t_table['I']="CTG"
t_table['J']="TGC"
t_table['K']="TCG"
t_table['L']="ATC"
t_table['M']="ACA"
t_table['N']="CTC"
t_table['O']="TGT"
t_table['P']="GAG"
t_table['Q']="TAT"
t_table['R']="CAC"
t_table['S']="TGA"
t_table['T']="TAG"
t_table['U']="GAT"
t_table['V']="GTA"
t_table['W']="ATG"
t_table['X']="AGT"
t_table['Y']="GAC"
t_table['Z']="GCA"
t_table[' ']="AGC"
t_table['.']="ACG"

dna=""

for i in inp:
    
    dna=dna+t_table[i]
print dna

m=0
r=3.0
f=0.5
n=0.0
dn=1.5


start_pos = 1
for i in dna:
    rate(10)
    n+=dn
    m+=1
    x = n
    y=r*sin(f*n)
    z=r*cos(f*n)
    a=sphere(pos=(x,y,z))
    #print x, y, z
    if (i == "A"):
        a.color=color.blue
    elif (i== "G"):
        a.color=color.red
    elif (i== "C"):
        a.color=color.green

Citing this post: Urbano, L., 2014. DNA Visualization, Retrieved October 22nd, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Return to 3rd Degree

May 18, 2013

Glass tile using the DNA Writer codon translation table.

Last weekend, I took the Glass Art Sampler class at the Third Degree Glass Factory, and got to try my hand at making a paperweight, a glass tile, and a few beads. It was awesome.

I’d had the chance to make a paperweight when my Lamplighter class had visited St. Louis a couple years ago, so I had a general idea of some of the possibilities. This time, however, I had DNA sequences on the brain, and went in with a bit of a theme in mind.

The tiles were the easiest because all you need to learn how to do was cut glass — by scoring it and using a little pliers like device to break it along the score — and then arrange the tiles of colored and clear glass on a tile. The arrangement was placed in a flat kiln, and then a day or so later, you tile would be all melted together. Pretty simple for a beginner.

My glass tile arrangement sitting in the kiln.

There is, of course, a bit more to it than that. The way the glass is stacked can be used to create floating effects; some colors will react when melted in the kiln to give different colors; care needs to be taken to manage where bubbles show up in the cooled glass; among other things.

Since it’s easiest to make straight edged cuts in glass, I made four sets of square colored tiles — yellow, red, blue, and green — to make a nucleotide sequence based off the DNA Writer translation table (with the start and stop codons added in).


Paperweight

I tried something similar when making the paperweight.

A blob of molten glass.

Usually, you start with a blob of molten, clear glass on the end of a metal rod, and dip it into trays of colored glass shards that stick to the molten glass. You can then pull and twist the viscous glass with a large pair of tweezers to blend the colors and make pretty patterns. The twisted glass is then pushed into a blob at the end of the rod, and the whole thing encased in more clear glass.

Twisting the glass.

Instead, I wanted to create a discernible pattern of colors to create a multi-colored helix of molten phenocryst-like blobs in the clear glass. I really wasn’t sure how to make it work. I though perhaps I could dip the initial glass blob into a pattern of shards and then pull it out once while twisting to get the spiral pattern. Our instructor was patient as I tried to explain my ultimate goal, and he came up with a more subtle method for making the spiral.

A pattern of colored glass chips.

I laid out the short pattern of colored glass shards and carefully dipped the initial blob of clear glass into it. All the shards stuck, which was good. Then instead of pulling with tweezers, the instructor helped my gently roll the blob of glass along a metal surface at a slight downward angle. Contact with the metal cooled the tip of the glass faster than rest of the blob causing the whole thing to twist just nicely. After smoothing things with a block we covered it with more clear glass (and smoothed again), and were done.

One week later:

Half a double helix encased in glass.

Working with big blobs of extremely hot glass is quite challenging, so I couldn’t replicate this on my own at the moment. I may have to take another class.

Glass Beads

The instructor melts a yellow glass rod in the flame and drops the molten glass onto a thin metal rod to create a bead.

I would feel comfortable making glass beads after the one class, but mastering the art is going to take a lot of practice. The flame — created from a mix of fuel gas (propane I think) and oxygen — is quite hot, and it takes some expertise to be able to melt the glass and twirl it onto the rods to make a nice round bead. The trickiest part, however, is making little colored dots to decorate the bead. You need to melt small bits of glass for the dots, then move the bead through the flame to warm it up enough so the dot will stick to the bead while not melting the bead too much. Then you pass the bead through the flame again to set the dot. If the bead or the dot is too cool when they’re put together the dots will pop off. I had a lot of popping dots.

I was not able to get my nucleotide sequence onto a bead in the time I had, but I did at least get to make a couple beads.

Citing this post: Urbano, L., 2013. Return to 3rd Degree, Retrieved October 22nd, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Embeddable DNA

May 7, 2013

Ravenclaw’s four genes on the DNA string annotated. Note that start and stop codons bracket each gene, and there is non-coding (junk) DNA between each gene.

Using English words like “blue eyes” to represent genes in DNA strings with the DNA Writer runs the risk that students start to wonder if actual genes are coded in English.

I’d say it was a small risk, but today I did have that question from a couple of students today.

Fortunately, it was quite easy to disabuse them of the impression: they didn’t actually believe it, but they just had to know for sure.

I did like one of the questions though, “Does that mean that Spanish people have DNA written in Spanish?”

Embedding the Tiles

With that caveat, since I, and a few of my students, like the pretty patterns the DNA Writer produces (see above), I created a way to embed the color sequences into other webpages like this blog.

By default, the embedded image links back to the DNA Writer website, but you can adjust it so that it does not. Instead, the nucleobase tiles will change color when you click on them. The color changing helps keep track of where you are if you’re trying to string the sequence in beads.

For academic purposes, you can also change the message you get when the mouse hovers over the tiles. By default it give the plain English translation, but you can make it say whatever you want, or even have it just show the base sequence.

Citing this post: Urbano, L., 2013. Embeddable DNA, Retrieved October 22nd, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Meiosis: Passing on Half of Your Genes

May 2, 2013

Now that we have an idea of what a strand of DNA looks like we’re going to start talking about how our genes are passed on to our kids.

During normal time (interphase) our DNA is stored in the nucleus of our cells. Humans have 23 pairs of chromosomes. Of each pair, one comes from your mom and one from your dad.

The 23 pairs of human chromosomes. One chromosome in each pair comes from each parent. Image from the NIH.

When a cell is not reproducing (which is most of the time) the chromosomes are unspooled threads in the cell’s nucleus.

An unspooled strand of DNA in the cell nucleus.

When the cell is preparing to reproduce, each DNA strand duplicates.

Each chromosome duplicates in preparation for cell reproduction.

Then they fold up into the chromosomes and line up in the center of the cell.

DNA folded into chromosomes in the cell nucleus. The centrioles (plastic cups) move to opposite sides of the cell nucleus.

Now this is where interesting things start to happen. In mitosis, each chromosome pairs up with its duplicate, so when these are pulled apart you get two new cells with exactly the same DNA.

Mitosis produces two identical cells. Image from the NIH.

In meiosis however, where the cell breaks apart into reproductive cells called gametes, the two parent chromosomes pair up and exchange some DNA before being pulled apart (the DNA exchange is called crossing over). Since the DNA has duplicated before this happens, when the cell splits, you end up with two new daughters with mixed up DNA. Each daughter nucleus has two chromosomes, like all your other cells, but unlike every other (non-reproductive) cell in your body those chromosomes are different because of the DNA mixing. In addition, in the last step of meiosis (called Meiosis II) each daughter cell splits apart into two more daughter cells (granddaughter cells?) each with only one chromosome.

Meiosis produces four cells (gametes), each of which has only half as many chromosomes as one of your normal cells. Image from the NIH.

Again, it’s important to note that because of the crossing over and the second splitting, when everything is done, you end up with four cells — called gametes –, each of which has its own unique DNA. And unlike the other cells in your body, which have 23 pairs of chromosomes, each gamete only has 23 chromosomes.

Because a normal cell has 23 pairs of chromosomes is called a diploid cell. The gametes with only 23 single chromosomes is called haploid. These haploid gametes are the reproductive cells — eggs and sperm.

Thus, the DNA you contribute to your kids is not the same strands that you have in your cells, but a halved mixture of the two sets of genes you got from your parents.

References

The NIH has an excellent primer called “What is a Cell” on the history of cells, their parts, and how they split.

Citing this post: Urbano, L., 2013. Meiosis: Passing on Half of Your Genes, Retrieved October 22nd, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Beading DNA

April 29, 2013

A small group of students use the DNA Writer website (on an iPad) to assemble a string of beads to represent a four genes on a piece of DNA.

Meiosis is a little hard to explain and follow, even with the videos to help, so I thought I’d try a more concrete activity — making DNA strands out of beads — to let students use their hands to follow through the process.

I started them off making a simulated human with four genes. They got to choose which genes, and they went with: hair color, number of eyes, height, and eye color. Then each group picked a different version of the gene (a different allele) for their person. Ravenclaw’s, for example, had brunette hair, three eyes, was tall, and had red eyes. Using the DNA Writer translation table , which maps letters and text to codons, they were then able to write out a string of DNA bases with their person’s information. I had them include start and stop codons to demarcate each gene’s location, and put some non-coding DNA in between the genes.

Ravenclaw’s Sequence

TAGGAATTGCATCACGATCTCCTATAGTAGCTATAACTAATCCCACCG
TTGGTGTAAACTCATATATGCTATGCATTGTAGACTATCATCTAAATG
GATTCGGACCATTCGTTGCACCTATACTAATCAGCATGCATC 

Since DNA is made up entirely of only four bases (A, C, T, and G), students could string together a different colored bead for each base to make a physical representation of the DNA strand. To make this a little easier, I adapted the DNA Writer to print out a color representation of the sequences as well. Most of the students used the color bars, but a few preferred to do their beading based off the original sequence only.

Ravenclaw’s DNA sequence color coded, and translated back to English (note the start and stop codons and the non-coding DNA in between each gene.

Just the beading took about 40 minutes, but the students were remarkable focused on it. Also, based on students’ questions while I was explaining what they had to do, the beading really helped clarify the difference between genes and alleles, and how DNA works.

Ravenclaw’s bead strand.

Ravenclaw’s four genes on the DNA string annotated. Note that start and stop codons bracket each gene, and there is non-coding (junk) DNA between each gene.

Each of these DNA strands represents the half-sequence that can be found in a gamete. Next class, we’ll be using our DNA strands to simulate fertilization, mitosis and meiosis. Meiosis, should be most interesting, since it is going to require cutting and splicing the different strands (to simulate changing over), and following the different alleles as four new gametes are produced. This will, in turn, lead into our discussion of heredity.

Citing this post: Urbano, L., 2013. Beading DNA, Retrieved October 22nd, 2017, from Montessori Muddle: http://MontessoriMuddle.org/ .
Attribution (Curator's Code ): Via: Montessori Muddle; Hat tip: Montessori Muddle.

Creative Commons License
Montessori Muddle by Montessori Muddle is licensed under a Creative Commons Attribution-Noncommercial-Share Alike 3.0 United States License.