CSI: TFS

Identifying the culprits using blood testing.

At the suggestion of Mr. Elder, I put together a Crime Scene Investigation (CSI) simulation for one of our afternoon interim activities. Sixteen students were challenged to solve a murder/mystery using simulated blood tests, fingerprinting, hair analyses, and chemical tests for drugs. And the assailants and the victims were members of the group.

I set up the crime scene with four different lines of evidence — fingerprints, hair, blood, and drugs — and forensic methods, so I could break my students up into four groups. The students were all told that they were competing to solve the mystery; to find out what happened and who did what to whom. Without any coaxing, the groups each claimed proprietary rights one type of evidence and set about trying to solve the mystery on their own. Since none of the lines of evidence could explain everything from the crime scene they ended up having to combine what they all found.

A blood soaked murder weapon (also with fingerprints and hair sample).

The Crime Scene

There were two weapons lying on the floor: a bloody knife and a bloody rolling pin with a hair stuck to it. On the table above the weapons were a few lines of white powder. There seemed to have been originally four lines, but one and one half of them had been used. There were fingerprints and a strand of hair next to the powder lines.

Also on the table, close to the powder, were a deck of cards (with fingerprints), a set of poker chips, a scale, and another stray hair.

Fortunately for our detectives, the fingerprints and hair had already been pulled and tagged.

Acquiring the Evidence

It took quite a bit of effort to acquire and plant the evidence. Some of it, like the blood, was simulated, but I had to get the hair and fingerprints from the students themselves. Since the individuals who chose this activity were a self-selected fraction of the middle and high-schoolers, I wandered around the building at lunchtime at the breaks between classes trying to find one or two students who were by themselves or were in a group with others who had not chosen the CSI activity.

The crime scene setup really only requires evidence of two people, but to keep it a little more mysterious I used a little misdirection. I got five students to contribute fingerprints and hair, but told them all that they’d be the murderer. I also got one person who was not in the class to contribute as well so we’d have a set of completely mysterious evidence.

Fingerprints

I pulled fingerprints by having students rub their fingers on a black spot I’d created using a basic number 2 pencil. The student would get the black graphite on their fingers and then touch their fingertips to the sticky part of some clear tape. The fingerprints turned out quite clearly that way.

Since I did not have time to figure out how to transfer the fingerprints to the surfaces I wanted them on, I just stuck the pieces of clear tape where I wanted them in the crime scene, which also saved the detectives a bit of time and effort.

Once I told them how to get the fingerprints from their peers, the students did not need any other guidance about how to analyze the fingerprints. They took the imprinted sticky tape and stuck them to a sheet of white paper, where the black prints showed up quite nicely. Then they fingerprinted everyone in the classroom and compared, looking for whirls and swirls primarily, but also basing their conclusions on the size of the prints which they took to be indicative of gender.

Of the four sets of prints, they were able to accurately identify the two people who were holding the knife and the rolling pin. The misidentified the one set that was from a person not in the class, and could not find the match for the last set.

Interestingly, of the four students in the group, two did most of the work while the other two wondered off to join other groups.

Hair

Hair was easy enough to collect since the students were quite happy to donate one or two for the cause. One hair per student would have been sufficient, but I kept loosing them until I just decided I’d stick them onto a piece of clear sticky tape and leave the sticky tape with hair attached at the scene of the crime.

With only a little nudging, the group working on the hair realized that they could get out one of the compound microscopes to examine their specimens, and compare them to the students in the class.

One major indicator that helped with the hair identification was the length. Two of the hair samples were from girls with long hair, while one was from a fairly short haired boy. I did consider just leaving pieces of the hair as evidence, instead of whole strands, but it’s a good thing I did not since, for one reason or another, the hair group had a difficult time identifying the owners of their samples (lack of effort might have been one part of it). It did help a bit that the two major perpetrators of the crime were members of that group.

Drugs

My idea here was to simulate a drug (cocaine) deal gone bad because of a contaminated/cut product. I laid out three lines of corn starch to simulate the cocaine and one line powdered glucose in between the last two cocaine lines to represent the adulterated drug. I removed the last cocaine line and half of the glucose line to make it look like someone had been ingesting the lines and stopped part-way through.

The lines of powdered substance (cocaine) were severely disrupted by student's sampling, but you can still see the two full lines to the right and the half line that the spatula is touching. — The lines of powdered substance (cocaine) were severely disrupted by student’s sampling, but you can still see the two full lines to the right and the half line that the spatula is touching.

Since we’ve been testing for simple and complex carbohydrates in biology and chemistry classes I told the group testing the drugs that the test for cocaine was the same as the iodine test for starch: if you add a drop of potassium iodine to a starch solution then it turns black.

If the students had examined the drugs on the table closely enough they should have been able to see that the glucose line was different from the others; it was not as powdered (so the crystals were small but visible), and it did not clump as much as the corn starch. However, they did not, and I had to hint that they should perhaps test all the lines of powder instead of just the first sample they took.

When they discovered that one of the powder lines did not react with the potassium iodine, I told them that a common adulterant was sugar so they should perhaps test for that. One of the students remembered the Benedicts solution test, which they were able to easily conduct since I’d already had the hot water bath set up for them.

Looking through the United Nations Office on Drugs and Crime’s Recommended Methods for the Identification and Analysis of Cocaine in Seized Materials, it seems that a common test for cocaine (the Scott test) turns a solution blue when the drug is present, so the next time I try this I may have to find some tests that produce a similar color change.

Blood/DNA testing

Simulating the blood testing was one of the trickier parts of the procedure for my part since I had to keep things very organized when students started being sent to me to be blood tested.

The blood was actually a few drops of food coloring diluted into 10 ml of water. I used three drops of red in each case to try to at least get it to a somewhat blood-like color, but then in mixed in one or two other colors to get five unique blood types.

The number of drops of food coloring mixed with 10 ml of water to get the 5 blood types.

Type 1: 3 red + 1 blue
Type 2: 3 red + 1 green
Type 3: 3 red + 1 yellow
Type 4: 3 red + 1 green + 1 yellow
Type 5: 3 red + 1 blue + 1 yellow

To match everything up with the crime scene, I assigned Suspect A to have Blood Type 2, and Suspect B to have Blood Type 4. So a sample of Blood Type 4 went on the knife, and a sample of Type 2 went on the rolling pin.

As a result, when the blood type testing group wanted to blood test everyone in the classroom, I had them send the students to me one at a time and I handed each student a small cup with a random sample of one of the Blood Types, except for the two students whose blood were on in the crime scene. With 16 students, we ended up with three or four students with each blood type.

Blood type testing using chromatography. The little containers of food coloring can be seen to the upper left.

This blood sample -- from the rolling pin -- is beginning to separate into its constituent colors (red, yellow and blue). — This blood sample — from the rolling pin — is beginning to separate into its constituent colors (red, yellow and blue).

The students took their blood samples back to the testers who I’d shown a simple chromatography method. They’d cut out thin (< 1cm wide) strips of coffee filter, put a drop of the blood sample on the middle of the strip, and then taped it down to a sheet of clear overhead transparency film. Although any clear glass or plastic would have worked, the transparency film was nice because you could tape five coffee filter strips to one sheet and then loosely roll the sheet up and put one end into a partially filled beaker of water (see Figure above). Capillary action sucked the water up the strips and smeared out the blood samples so you could see its constituent colors. The method worked pretty well, and the students were able to compare the blood at the crime scene to their test results to identify the small group of people who shared the suspect blood types. It was a lot of work, and it would have taken much longer if the group doing it were not amazingly organized and worked extremely well together.

This method is more akin to blood type testing than DNA testing, which I’d have liked to simulate better, however I did not have the time to work on my chromatography method.

In Conclusion

It took a little coaxing to get them to the right conclusion in the end, but I and the student had a lot of fun solving the mystery.

From DNA to Proteins: A Simulation Game

dna-lab-molecule-3332 — Figure 1. Students assemble a molecule after translating the instruction from the gene sequence.

Abstract

This simulation was designed to have middle school students practice reading instructions (proteins) from a sequence of genetic bases (DNA) to better understand how gene translation works and learn the types of things that proteins do. The exercise and discussion lasted 55 minutes (with one preparatory homework assignment). Students appeared to have a lot of fun doing the simulation (especially because of the competition between groups) and we had an excellent discussion afterwards.

Introduction

DNA holds the instructions that control what our bodies in the pattern of molecules (nucleobases) that make up our genes. The genes are located in the nucleus of our cells (as well as for all eukaryotes). When genes are expressed, they create proteins that actually get all the work done.

The jobs of proteins can be summed up a three things:

some proteins build structures like muscles,
other proteins are enzymes that catalyze reactions, like the breakdown of food in the digestive system, and
other proteins are used for sending messages.

Using the DNA Writer application for converting text into simulated DNA sequences, I create an exercise for students to practice:

Finding simulated genes in a DNA sequence
translating the genetic code into an instruction (a simulated protein)
performing the different types of jobs that proteins do.

The simulation was modeled as a competitive game, with the class of 7th and 8th graders broken into four groups that competed against one another to see who could complete the instructions the fastest. I cheated, I’m afraid, because what I did not tell them was that, in order to complete the last instruction, the groups would all need to work together, so there would be no single group winner.

Procedure

Pre-exercise Homework

Example Homework Assignment: HW-eg.pdf

This being the first time I’ve tried anything like this, I was not sure how long it would take students to translate the DNA code to english, so a couple days before the simulation I handed out individualized homework assignments so they could practice. I chose science vocabulary words like “protein”, “ribosome”, and “amino acids” for short, simple messages.

amino-acid-seq — Figure 2. This homework assignment consists of a simulated DNA sequence, the translation table, some instructions on how it works that comes from the DNA Writer app (use the printer friendly output option). The assignment can thus be individualized. This message translates as “amino acids”. Students were able to do the translation in less than five minutes. (pdf)

At least I had intended for it to be homework. As soon as they got the handout, and the 2 minute explanation about how it worked, they hashed out the messages in about five minutes.

The trickiest part was that the first few letters they translated did not make any sense, since they’re random sequences meant to represent non-coding DNA. However, once they got to the “start” codon it was pretty easy sailing.

Given how fast they were able to do the translation (and how eager and enthusiastic they were about it), I realized how unfounded were my fears that the translations would take too long for the competitive part of the exercise to work.

The Simulation/Exercise

Materials

There are only a few materials required for this lab:

envelopes – one for each group (size does not matter)
a chain of paperclips (100 seemed to work pretty well) You only need one set of 100 because the groups will be working on this together.
enough parts of a molecule-building kit to make a methane molecule (CH₄).
printout of the translation table (eg. HW-eg.pdf or from DNA Writer).

dna-activity-materials — Figure 3. Materials and printouts used in this activity.

Preparation

For each group

Write out the main set of instructions. The instruction I used were:
- PULL APART ALL THE PAPERCLIPS
- BUILD A METHANE MOLECULE
- BUILD A BUTANE MOLECULE
I used the DNA Writer to get the code for each instruction individually then stuck them together in a text editor (like Word) (Note: it might even be better to give them a bead string with the base sequence instructions). These three instructions together looked like this:

TATTGCACATTGGAGGATATCATCAGCACTGAGACTCACT
AGAGCACTATCATCAGCTAGCGTCTAAGCGAGACTGAGCT
ACACTCAATCCTGGAGTGATAACTCTCACTAGTATAGTCG
TTGCATGATCTGATCTACAGCACTAGCACACTATAGCGTA
CTCTCCTAAGCACATGTATCCTATCAGATATCCTATAATG
TCTATGCGTATCATTGCATGATCTGATCTACAGCACTAGC
CATGATTAGACTCTCCTAAGCACATGTATCCTATCAGATA
TCCTATAAGCAATCCACGCT

Write or print out an address label as a DNA sequence, and stick it on to the envelope.
- Since my groups had already named themselves, my addresses were something along the lines of, “Give to Gryffendor”.
Write out a message and stick it into each envelope
- My messages were things like: “Do 10 pushups”; or “Dance Gangnam Style”.

Chain together the paperclips:
- The groups will be working together to pull apart the paperclips, so you want enough paperclips so that it takes a few minutes to do. This way the slower groups will have a chance to catch up with the faster groups.
Put the molecule building parts in a jar – one for each group.

Procedure

So I took the class to the gym and stuck each of the four groups on a side of the basket ball court. Each group had a jar of molecule parts (only enough to build a methane molecule), an addressed letter with a message in it, and the long DNA sequence.

The paperclips were in a box in the center circle of the court.

We gathered around the center circle for instructions, which basically consisted of me telling them they had to

deliver their message first,
then do the whatever was in the message delivered to them,
then follow the instructions in the long DNA sequence

They were eager to go.

Results

dna-lab-methane-3333 — Methane molecule assembled.

The entire thing went remarkably smoothly, which was somewhat surprising since this is the first time I’ve ever tried anything like this.

It only took 20 minutes from the time they started to when they finally put together the butane molecule.

A few small issues did come up, however.

Since they had only ever decoded a single instruction from a single DNA sequence before, almost all the groups stopped after the first instruction on the long sequence (pull apart the paperclips). I had to point out that a real DNA sequence contains a whole sequence of genes, so they probably ought to continue translating.

Another group tried doing shortcuts, and when they saw that they had parts from the molecule building kit and the instruction was, “BUILD A M”, they assumed that they were just supposed to build any molecule. I had to intervene on that one too.

dna-lab-paperclip_chain-3329 — Figure 4. Each group contributed one person to pulling apart the paperclip chain. Pulling apart the paperclips represents the catalytic breakdown of long polymers in food (starches and proteins for example) by enzymes.

When the person from the third group arrived to help pull apart the paperclips, the two already there complained that more people would just slow them down. I had to point out that they could just break the long chain they were working on into smaller pieces and then everyone could work and the work would go a lot faster. The breaking of the chains is supposed to represent the catalytic effect of enzymes.

One group mistakenly blocked off the first two letters in the DNA sequence instead of the first three (for a codon), and couldn’t figure out why their sequence was not telling them anything. I had to help out with that one, but in our post-simulation discussion it reminded me to talk about transcription errors and how the genetic code can change.

Finally, they were, some more than other, sorely disappointed that there would be no winner. They so wanted to win that they did not want to share their molecule parts to build the butane molecule.

dna-lab-butane-detail-3337 — Figure 4. A student holds a butane molecule model.

Discussion

When we were done with the exercise, we gathered around in the center circle to debrief. We reviewed what DNA does and the three things that proteins do:

Assembling the butane molecule from the methane monomers represented the use of proteins to build structures.
Pulling apart the paperclips represented the breakdown of food in the digestive system. Starches, for example, are long chained polymers that are broken down into their constituent sugars by enzymes in saliva and in the stomach.
The envelope with the message was a very literal representation of proteins as message carriers.

I actually forgot to talk about the transcription errors one group was making during our circle discussion, so we ended up talking about it on the following day. One student had remembered the video I showed earlier about gene expression that compared the rate of errors in DNA encoding compared to computer disks. The DNA coding is much more reliable, but when billions upon billions of bases are being coded then errors will still creep in.

This lead to a discussion about mutations, and how some DNA transcription errors could give messages that made no sense and would be ignored, while others could send signals that could affect the body’s functions. The latter types of mutation can be good or bad.

Conclusion

The exercise went remarkably well. Key to it, I think, was the fact that the students were able to so efficiently translate the DNA code to English. Also, the instructions were designed to feed back into things they’d done in the past, like assemble covalent molecules and polymers.

Poor Mom

My students are playing SPENT (previous post), and some of them have figured out how to easily make it to the end of the month even while living in poverty. Unfortunately, lots of moms are going without crucial medication.

At least this will contribute to a nice discussion of ethics and morality.

Velasquez and other, (2010) have a nice explanation of “What is Ethics?“.

Ethics is two things. First, ethics refers to well-founded standards of right and wrong that prescribe what humans ought to do, usually in terms of rights, obligations, benefits to society, fairness, or specific virtues. … Secondly, ethics refers to the study and development of one’s ethical standards. … feelings, laws, and social norms can deviate from what is ethical. So it is necessary to constantly examine one’s standards to ensure that they are reasonable and well-founded.

—Velasquez et al., 2010: What is Ethics?

While the Stanford Encyclopedia of Philosophy has a great definition of morality:

The term “morality” can be used either
1. descriptively to refer to a code of conduct put forward by a society or,
— 1. some other group, such as a religion, or
— 2. accepted by an individual for her own behavior or
2. normatively to refer to a code of conduct that, given specified conditions, would be put forward by all rational persons.

—Gert (2008): The Definition of Morality (The Stanford Encyclopedia of Philosophy)

In fact, given how difficult it is to win the game without making some hard moral choices, a couple very interesting questions for a Socratic dialogue would be,

“Can someone survive in poverty while living ethically?”

and, to follow up,

“Does this push poorer people into being unethical and immoral, and towards crime?”

I’m curious to see where a dialogue might lead, especially if it leads back to our discussions of wealth distribution.

Kilobucks and capitalism

Well, it’s really kilobucks and economic systems, but that does not have the same rhythm for a title. We’re reprising the market versus socialist economies simulation game, my student came up with last year for his IRP.

I though I’d also include a little lesson on the metric system as a subtext. Hence the creation of the kilobuck. I’ll also talk about the centidollar, decidollar, decadollar and hectadollar.

kilobuck2 — One kilobuck, the official currency of the market versus socialist economy simulation game.

Egyptian Protest Simulation

For the record, the following was my attempt to simulate the current Egyptian protests. I tried this one afternoon after the class had watched a particularly stirring video of the protesters, and my intention was to give students with a simplified picture of what was going on and who was doing it. We’re not covering revolutions until next year, but the current events in Egypt are too important to ignore.

The Players

1. Hosni Mubarak

Hosni_Mubarak_ritratto — Hosni Mubarak. (Image by Presidenza della Repubblica via Wikimedia Commons)

Hosni Mubarak is the President of Egypt and autocrat for the last thirty years. I tried to match students, in a rough and ready way, to the personality/characteristics of the people and groups they were supposed to represent, so for Mubarak I picked someone who could think fast on their feet and would play the role to the end, not giving up easily to the demonstrators just because they (as I believe all my students are) are sympathetic to their cause.

2. The Secret Police (also pro-regime “protesters”)

egypt-id — This ID is of an undercover security officer who tried to start a fight, he was apprehended but not hurt, however, he said he was paid to come and start trouble. (via Al Jazerra English)

The student playing the secret police was given a weapon, a popsicle stick, with which he could attack the protesters, but was not powerful enough to “kill” anyone on its own. He had to follow the instruction of Mr. Mubarak. I chose one of my more kinetically oriented students for this role, and he spent a lot of time crawling under tables and harassing the protesters as they tried to make their signs.

I tried the simulation in class before the overnight battles where pro-Mubarak “protesters” attempted to take Tahrir Square, so I just briefed the student tasked with this job that he was the dreaded secret police. However, given that the anti-government protesters were able to beat of their attackers, and that police ID was found on captured attackers, I think the pro-government rioters can be lumped in with the secret police.

3. Barack Obama

Official_portrait_of_Barack_Obama — Barack Obama.

I chose my student whose major ambition is to be president for this role. He’s quite serious about it, and follows world politics, so could handle the tricky balance of deciding if to support a client who has provided stability (until now), as opposed to supporting the pro-democracy protesters, as his predilections would demand.

4. The Army

Egypt political crisis — Egyptian Army tanks in Tahrir Square in Cairo. (Image from Al Jazeera English)

This was another tricky role to play. The top brass tend to support the regime, while the enlisted soldiers and lower-level officers have shown support for the anti-government protesters. There was even a story of a lower level officer joining the protesters because his brother had been killed in the protests. The Army also has the tanks and power to decide things one way or the other if they so choose. They’re also well respected.

I gave the student playing the Army a simulated gun, but told him, in secret, that he only had three bullets, not enough to “kill” all the protesters.

5. The “People”

egypt-TV — The quiet majority. (Image from Al Jazeera English)

Despite all the people protesting in Tahrir Square, the vast majority of the population of Cairo are at home, worrying, watching things unfold on TV, trying to figure out what’s going on and what to do.

My quietest student got this job, one who could exhibit a lot of restraint, and be reluctant to do anything radical. They were instructed that their main role was to worry, but, if things got so bad that they had to take sides, whichever side they took would win. They were that powerful, but unaware or fearful of using that power.

6. Student Protesters

Despite the smile on the face of the student protester in the adjacent image, I instructed the student representing the young student protesters in Tahrir Square that those students were, at the core, angry and frustrated. They are educated so they know a bit of history and about politics. They know what things could be like, how things could be.

7&8. The Muslim Brotherhood

protest-egypt-02 — The Muslim Brotherhood.

I assigned two students to be the Muslim Brotherhood, given their relative size. They wrote their protest sign using Arabic characters since the Brotherhood, with all their charities, represent the poorer, less educated people (so they’re less likely to have English as a second language).

My students were told they were pious and work closely together, to represent the religious background of the Brotherhood and the discipline of the organization.

9. Middle Class Protesters

protest-egypt-03 — Middle class protester with young child.

In between the major street battles, when the protests swelled to their largest size, the middle class protesters came out. They have something to loose but want the best for their kids. Some of them brought their kids.

They’re educated and probably have a decent income. Although they’re not the loudest or most angry, these are the kind of people with the high per-capita incomes that you want for any new democracy to succeed.

10. Mohammed ElBaradei

Mohamed_ElBaradei — Mohamed ElBaradei (image from the IAEA).

ElBaradei is an interesting character in all the turmoil in Egypt. Westernized and liberal-minded, he’s spent a lot of time working for international organizations but has only focused on Egyptian politics in the last few years. As such, he doesn’t seem to have much of a grass-roots constituency.

I try to get my students to argue with me on the basis of logic rather than anything else, and I chose a student who’s rather good at it for this role. Protests, however, are driven more by logic than emotion. So when this student got frustrated and gave up after trying to organize the protesters, who they were all too busy making their signs, I thought added some unexpected verisimilitude to the simulation. (I had to prod them quite a bit to wrap up on the signmaking, otherwise we’d have gotten nothing else done for the rest of the day).

Missing

Putting all this together quickly did mean that I probably missed some major players, including, I suspect, the important role of the media.

Putting it all together

With the actors in place (and signs finally ready), my protesters marched on the square. The Army was caught in between the protesters and Mr. Mubarak. The “People” watched from the sidelines. Everyone had their say, from the perspective of their group, but I had to do a little coaching to keep them to their assigned tasks.

No one won in our simulation. It ended in a stalemate, because the only actor capable of bringing things to a conclusive end, the Army, could not decide which side to choose. Which is pretty much where Egypt has been for the last week. Until today.

Friends or Enemies

One of the more interesting observations from today’s reenactment of the ongoing protests in Egypt, was the almost instinctive eagerness of, at least some of the simulated protesters, to want to confront the simulated army.

egypt-in-your-face — 70. A demonstrator (L) argues with police during a protest in Cairo January 28, 2011. Police and demonstrators fought running battles on the streets of Cairo on Friday in a fourth day of unprecedented protests by tens of thousands of Egyptians demanding an end to President Hosni Mubarak's three-decade rule. REUTERS/Yannis Behrakis (via TotallyCoolPix)

One protester, who’d been given the role of “angry student demonstrator” was extremely eager to get in the face of the army.

We were, after all, playing a simulation game, and that particular student had been told that he was angry, frustrated with the lack of opportunities, and all riled up. However, the way the actual Egyptian protesters are dealing with the army is really important to observe. They’re treating them like the friends and brothers they actually are: taking them in, rather than fighting against them.

I did have one of the protesters offer to hug the “army”, so, in the end, I hope the message that co-option can be much better than confrontation.

Market vs. Socialist Economy: A simulation game

ben-4-prez-car — Figure 1. The ultimate vehicle. Produced in round 3 of the capitalisim simulation, this vehicle was carefully designed to match the preferences of the consumer. It earned 5 out of the 10 dollars spent in that round.

Abstract

The power of capitalism lies in the system’s ability to adapt to the needs of people. It does so by giving preferential rewards to those who best meet those needs as expressed in the market. As part his spring Independent Research Project, middle school student, Mr. Ben T., came up with a simulation game that demonstrates this advantage of capitalist systems over a communal systems that pays the same wage irrespective of the output.

Background

In either the fall or the spring term I require students to include some type of original work in their Independent Research Project (IRP). Most often students take this to mean a natural science experiment, but really it’s open to any subject. Last term one of my students, Ben T., came up with a great simulation game to compare capitalism and socialism. With his and his parent’s consent I’m writing it up here because I hope to be able to use it later this year when we study economic systems and other teachers might find it interesting and useful.

Procedure

The simulation was conducted with six students (all 7th graders because the 8th graders were in Spanish class at the time) who represented the producers in the system, and one student, Ben, who represented the consumers.

Simulating Capitalism

In the first stage, representing capitalism, the producers were told that the consumer would like a car or cars (at least a drawing to represent the cars) and the consumer would pay them based on the drawing. The producers were free to work independently or in self-selected teams, but only one pair of students chose to team up.

Producers were given three minutes to draw their cars, which they then brought to “market” and the consumer “bought” their drawings. The consumer had limited funds, 10 “dollars”, and had to decide how much to pay for each drawing. Producers were free to either accept the offered payment and give the drawing to the consumer or keep their drawing.

This procedure was repeated three times, each turn allowed the producers to refine their drawings from the previous round, particularly if it had not sold, or create new drawings. Since all drawings were offered in an open market, everyone could see which drawings sold best and adapt their drawings to the new information.

Simulating Socialism

Socialism was simulated by offering equal pay to all the producers no matter what car/drawing they produced. Otherwise the procedure was the same as for the capitalism simulation: students were told that they could work together or in teams; they brought their production to market; the consumer could take what they liked or reject the product, but everyone was still paid the same.

Assessment

At the end of the simulations consumer students were asked:

How did you change your car in response to the market?
Did it make the car better?
What do you think of a socialist system?
Which [system] do you prefer?

Results

Students showed markedly different behaviors in each simulation, behaviors that were almost stereotypes capitalist and communistic systems.

Capitalism simulation

Producers in the capitalist simulation started with fairly simple cars in the initial round. One production team drew a single car. Another made four cars with flames on the sides, while another went with horns (as in bulls’ horns rather than instruments that made noise) and yet another drew. When brought to market, despite the fact that almost all drawing were paid for, it quickly became obvious that the consumer had a preference for the more “interesting” drawings. The producer who drew six cars with baskets on top got paid the most.

j-car-r2 — Figure 2. Rocket launchers and shields were an important innovation in Round 2 of the capitalism simulation. It earned 4 of 10 dollars and influence all cars in the subsequent round.

In the second round one innovator came up with the idea of adding a rocket launcher (Figure 2) and was amply rewarded. In response, in the third round, the market responded to this information with enthusiasm, however, all the rocket launchers were trumped by a tank shooting fire out its back with, “Ben 4 Prez!” written on the side (Figure 1).

pm-cars-r1 — Figure 3a. Evolution of cars in response to consumer preferences. Example from paired producers: Capitalism. Round 1.

pm-cars-r2 — Figure 3b. Round 2. This set of producers go with multiple cars.

pm-cars-r3 — Figure 3c. Round 3. Train and cars with rocket launchers developed in response to the market's favorable response to weaponization in Round 2 (see Figure 2).

The producers responded the the preferences of the consumer. The best example of this was the work of the couple students who decided to pair-up.

Their first car was simple and straightforward and it only garnered one “dollar” (Figure 3a). In the second round they chose to go with quantity, producing a lot of cars (Figure 3b) as that had been a fairly successful strategy of another producer in Round 1. Their reasoning was that since there were two of them they would be able to outproduce the others. By the final round they had developed a train with rocket launchers in addition to a set of cars with rocket launchers (Figure 3c). Again, market pressures had an enormous influence on the final vehicles, but the individual philosophy of the producers also showed through in the vehicle production choices.

[UPDATE 5/17/2012]: The capitalism part of the simulation produces winners and losers, and a good follow-up is to do the distribution of wealth exercise to see just how much wealth is concentrated at the top in the U.S.. The second time I ran the simulation — with a different class — the students were quite put out by the economic disparity that resulted and ended up trying to stage a socialist revolution (which precipitated a counter-revolution from the jailed oligarchs).

Socialism Simulation

socialism-car — Figure 4. Cars produced under conditions of equal pay to all producers regardless of work.

Although three rounds were intended, time constraints limited the socialism simulation to a single round, however the results of that single round were sufficient for students to identify the main challenges with communal rewards for production. The producers decided that they would work together and produced two sets of basic cars (Figure 4). Half of the students did not even contribute, they spent their time just standing around. It was the stereotypical road construction crew scene.

capitalism-at-work — Figure 5. Industrious capitalists very focused on their work.

socialism-at-work — Figure 7. Socialists slacking off.

Survey Responses

All students who responded to the question preferred capitalism, the primary reason being injustice “… cause [during the socialism simulation] some people do nothin’ [and] other people do something.”

Discussion and Conclusion

Using only one consumer reduces the time needed for the simulation but limits students from seeing that markets can be segmented and different producers can fill different niches. It would be very interesting to see the outcome of the same simulation in a larger class.

The small class size also allowed the simulation to take place in less than half an hour. Most of the post processing of the information gained was done by the student who ran the simulation since it was part of his Individual Research Project. While he did a great job presenting his results at the end of the term, when I use this simulation as part of the lesson on economic systems I would like to try doing a group discussion at the end.

I’m also curious to find out how much more the cars would evolve if given a few more rounds. Which brings up an interesting point for consideration. Since some students have already done the simulation, it may very well influence their actions when I do it again this year. It would probably be useful to make sure that there are more than one consumers, or that there consumer has very different preferences compared to Ben T.. A mixed gender pair of students might make the best set of consumers.