Tag: biology

Constructing a Wooden Slide Tray

Handmade, 25 slot slide tray.
Handmade, 25 slot slide tray.

To have somewhere to store the slides I’ve been making, I needed a slide storage box. They’re pretty cheap, but they’re also pretty simple to put together with stuff I could, mostly, find around the house: some scrap wood (from an small wooden CD holder tray that I’m not using any more); a small sheet of clear acrylic (from the hardware store); a short piece of sticky-backed, rubber foam for insulating windows (to keep the slides pressed into place so they don’t move in the box); and some craft glue (ModPodge). For tools, all I used were a few clamps and the saw on a pocket tool.

Using the pocket saw was the biggest pain because I had to cut little slots into the wooden frame to hold the slides. Twenty five slides meant 50 slots, and although the wood was soft, the width of the blade was almost exactly the width of a slide, so if the slot was not perfectly vertical the slides would not fit properly and I’d have to carefully saw it a little bigger. The clamps were a big help with the sawing.

The base of the slide tray was put together with scrap wood and the saw on the pocket tool.
The base of the slide tray was put together with scrap wood and the saw on the pocket tool.

Making Slides: Mounting in Nail Polish

Close up of a fly’s smaller, rear wing 1 hour after being mounted in nail polish. Image taken using my compound microscope at 100x magnification.

Now that I have a few new microscopes, I’d like students to be able to make their own, permanent, slide collections. Walter Dioni has some superbly detailed pages on how to mount samples for microscopy. I could not find a good, up-front, index, so for the record, here are his pages on mounting slides:

Most of these methods use chemicals that are safe to work with (all are non-toxic), but using nail polish appears to be the easiest — it’s a mount and a sealant in one — so that’s the one I tried first, using a bottle of Strengthener, Nail Hardener. The Karo syrup, and glycerin methods also seem reasonably easy, and it may preserve some of the organic colors better so I may try those later when I have the time.

The fly’s rear wing one hour after being mounted in nail polish. Image taken using my compound microscope — 100x magnification.

P.S.: Dioni also has a good page on pollen microscopy.

Ticks in the Woods

While walking through the woods to recover the skeleton the other day, I picked up, or rather was boarded by, a few ticks. So when I got back to school I plopped them under the stereoscopes to try to identify them.

Lone star tick (Amblyomma americanum) (adult female?) from the woods behind Maggie’s house (Missouri). Magnification ~20x; dorsal view.

They were both lone star ticks (Amblyomma americanum): one adult and one juvenile.

Lone star tick nymph (magnification 45x; dorsal view).

Under the microscope, they were quite pretty with their very interesting red and black patterns.

Note:

Purdue’s extension service has an excellent reference page on basic tick anatomy and ecology for a lay audience, and Colonial Pest Control has a very readable overview of The Biology of Ticks (↬ Jay O.) that goes into their life cycles and how to deal with them.

Much greater detail can be found in the Tick Gross Anatomy Ontology, but the best reference I’ve found so far is the USDA’s Handbook (485): Ticks of Veterinary Importance (pdf). There you can find great anatomy diagrams and interesting biological and ecological information. One curious piece of information is that ticks can survive a long time (three years in one case) without a blood meal. It also includes some excellent diagrams:

Diagrams of lone star tick external anatomy from USDA Handbook 485: Ticks of Veterinary Importance.
External anatomy of hard bodied ticks. From the USDA Handbook 485: Ticks of Veterinary Importance.

A Skeleton in the Woods

Raccoon skeleton and bits of fur found in the woods behind Ms. Eisenberger’s house. Photo by Micaela Mason.

Just out of the blue, I got a text from Maggie (Eisneberger) yesterday saying, “Wanna see something awesome. Bring the kids.” Well I didn’t have the kids with me, but I went over anyway. She and her niece had found an almost complete skeleton in the woods.

Since I’ll be teaching biology next year, I’ve been on the lookout for a good skeleton. The last time I had one was when my middle school class found a raccoon skeleton on an immersion trip. They brought it back to school, cleaned it up, and reassembled it on a poster board. It was an awesome learning experience.

This skeleton is even more complete. Even some of the cartilage between the vertebrae was dried out and preserved. It was a bit puzzling that the whole skeleton seemed to be there, and had not been too disturbed by scavengers even though, based on the state of decay, it had been there for quite a while.

We collected as much as we could, although some of the smaller bones in the hands and feet are quite tiny.

Maggie lent me her book on the animals of Missouri so I could try to identify it based on the teeth. However, later yesterday evening I got an email from her. She’d been talking to her brother, who’d, back in March, shot a raccoon that was going after his chickens. He’d left the body out in the woods.

Well now someone/s will have a nice little project in the fall.

Windows and Warblers

Unfortunately, the method of the demise of the worm-eating warbler that flew into our window appears to be more the rule than the exception. David Sibley (2010) calculates that windows are the number one, people-influenced, cause of death for birds.

Main anthropogenic causes bird mortality. Chart by David Sibley.

Notice that cats are number two on the list.

What are the odds?

Three successful oregano plants out of four cuttings.

My middle school class stumbled upon a nice probability problem that I might just use in my pre-calculus exam.

Oregano

You see, four of my students took cuttings of oregano plants from the pre-school herb gardens when we were studying asexual reproduction, but only three of them grew roots.

That gives a 75% success rate.

P[success] = 0.75

The next time I do it, however, I want each student to have some success. If I have them take two cuttings that should increase the chances that at least plant will grow. And we can quantify this.

If the probability of success for each cutting is 75% then the probability of failure is 25%.

P[failure] = 0.25

Given a probability of one plant failing of 25%, the probability of both plants failing is the probability of one plant failing and the other plant failing, which, mathematically, is:

P[2 failures] = P[failure] x P[failure]

P[2 failures] = 0.25 x 0.25

P[2 failures] = 0.252

P[2 failures] = 0.0625

So the probability of at least one plant growing is the opposite of the probability of two failures:

P[at least 1 success of two plants] = 1 – P[2 failures]

P[at least 1 success of two plants] = 1 – 0.0625

P[at least 1 success of two plants] = 0.9375

which is about 94%.

If I had the students plant three cuttings instead, then the probability of at least one success would be:

P[at least 1 success of 3 plants] = 1 – P[3 failures]

P[at least 1 success of 3 plants] = 1 – 0.253

P[at least 1 success of 3 plants] = 1 – 0.02

P[at least 1 success of 3 plants] = 0.98

So 98%.

This means that if I had a class of 100 students then I would expect only two students to not have any cuttings grow roots.

An Equation

In fact, from the work I’ve done here, I can write an equation linking the number of cuttings (let’s call this n) and the probability of success (P). I did this with my pre-calculus class today:

P = 1 - 0.25^n

so if each student tries 4 cuttings, the probability of success is:

P = 1 – 0.254

P = 1 – 0.004

P = 0.996

Which is 96.6%, which would make me pretty confident that at least one will grow roots.

However, what if I knew the probability of success I needed and then wanted to back calculate the number of plants I’d need to achieve that probability, I could rewrite the equation solving for n:

Start with:
P = 1 - 0.25^n

isolate the term with n by moving it to the other side of the equation, and switching P as well:
0.25^n = 1 - P

take the natural log of both sides (we could take the log to the base 10 if we wanted, or any other base log, but ln should work just as well).

\ln{(0.25^n)} = \ln{(1 - P)}

now use the rules of logarithms to bring the exponent down into a multiplication:

n \ln{(0.25)} = \ln{(1 - P)}

solving for n gives:

n = \frac{\ln{(1 - P)}}{\ln{(0.25)}}

Note that the probability has to be given as a fraction (between 0 and 1), so 90% is P = 0.9. A few of my students made that mistake.

Lavender

Roots on two of three plants.

At the same time my students were making oregano cuttings, six of them were making cuttings of lavender. Only one of the cuttings grew.

So now I need to find out how many lavender cuttings each student will have to make for me to be 90% sure that at least one of their cuttings will grow roots.

Students can do the math (either by doing the calculations for each step, or by writing and solving the exponential equation you can deduce from the description above), but the graph below shows the results:

Probabilities of successfully growing a lavender cutting.

Beading DNA

A small group of students use the DNA Writer website (on an iPad) to assemble a string of beads to represent a four genes on a piece of DNA.

Meiosis is a little hard to explain and follow, even with the videos to help, so I thought I’d try a more concrete activity — making DNA strands out of beads — to let students use their hands to follow through the process.

I started them off making a simulated human with four genes. They got to choose which genes, and they went with: hair color, number of eyes, height, and eye color. Then each group picked a different version of the gene (a different allele) for their person. Ravenclaw’s, for example, had brunette hair, three eyes, was tall, and had red eyes. Using the DNA Writer translation table , which maps letters and text to codons, they were then able to write out a string of DNA bases with their person’s information. I had them include start and stop codons to demarcate each gene’s location, and put some non-coding DNA in between the genes.

Ravenclaw’s Sequence

TAGGAATTGCATCACGATCTCCTATAGTAGCTATAACTAATCCCACCG
TTGGTGTAAACTCATATATGCTATGCATTGTAGACTATCATCTAAATG
GATTCGGACCATTCGTTGCACCTATACTAATCAGCATGCATC

Since DNA is made up entirely of only four bases (A, C, T, and G), students could string together a different colored bead for each base to make a physical representation of the DNA strand. To make this a little easier, I adapted the DNA Writer to print out a color representation of the sequences as well. Most of the students used the color bars, but a few preferred to do their beading based off the original sequence only.

Ravenclaw’s DNA sequence color coded, and translated back to English (note the start and stop codons and the non-coding DNA in between each gene.

Just the beading took about 40 minutes, but the students were remarkable focused on it. Also, based on students’ questions while I was explaining what they had to do, the beading really helped clarify the difference between genes and alleles, and how DNA works.

Ravenclaw’s bead strand.
Ravenclaw’s four genes on the DNA string annotated. Note that start and stop codons bracket each gene, and there is non-coding (junk) DNA between each gene.

Each of these DNA strands represents the half-sequence that can be found in a gamete. Next class, we’ll be using our DNA strands to simulate fertilization, mitosis and meiosis. Meiosis, should be most interesting, since it is going to require cutting and splicing the different strands (to simulate changing over), and following the different alleles as four new gametes are produced. This will, in turn, lead into our discussion of heredity.