Middle and High School … from a Montessori Point of View
A neat stop-motion movie made by manipulating individual atoms.
This is a great spark-the-imagination video because you can use it to talk about the physics of atoms and molecules, and what is temperature — they had to cool the atoms down to 4 Kelvin to keep them from moving too much.
How they did it:
More detail from Slate, and NPR:
Now that we have an idea of what a strand of DNA looks like we’re going to start talking about how our genes are passed on to our kids.
During normal time (interphase) our DNA is stored in the nucleus of our cells. Humans have 23 pairs of chromosomes. Of each pair, one comes from your mom and one from your dad.
When a cell is not reproducing (which is most of the time) the chromosomes are unspooled threads in the cell’s nucleus.
When the cell is preparing to reproduce, each DNA strand duplicates.
Then they fold up into the chromosomes and line up in the center of the cell.
Now this is where interesting things start to happen. In mitosis, each chromosome pairs up with its duplicate, so when these are pulled apart you get two new cells with exactly the same DNA.
In meiosis however, where the cell breaks apart into reproductive cells called gametes, the two parent chromosomes pair up and exchange some DNA before being pulled apart (the DNA exchange is called crossing over). Since the DNA has duplicated before this happens, when the cell splits, you end up with two new daughters with mixed up DNA. Each daughter nucleus has two chromosomes, like all your other cells, but unlike every other (non-reproductive) cell in your body those chromosomes are different because of the DNA mixing. In addition, in the last step of meiosis (called Meiosis II) each daughter cell splits apart into two more daughter cells (granddaughter cells?) each with only one chromosome.
Again, it’s important to note that because of the crossing over and the second splitting, when everything is done, you end up with four cells — called gametes –, each of which has its own unique DNA. And unlike the other cells in your body, which have 23 pairs of chromosomes, each gamete only has 23 chromosomes.
Because a normal cell has 23 pairs of chromosomes is called a diploid cell. The gametes with only 23 single chromosomes is called haploid. These haploid gametes are the reproductive cells — eggs and sperm.
Thus, the DNA you contribute to your kids is not the same strands that you have in your cells, but a halved mixture of the two sets of genes you got from your parents.
The NIH has an excellent primer called “What is a Cell” on the history of cells, their parts, and how they split.
Meiosis is a little hard to explain and follow, even with the videos to help, so I thought I’d try a more concrete activity — making DNA strands out of beads — to let students use their hands to follow through the process.
I started them off making a simulated human with four genes. They got to choose which genes, and they went with: hair color, number of eyes, height, and eye color. Then each group picked a different version of the gene (a different allele) for their person. Ravenclaw’s, for example, had brunette hair, three eyes, was tall, and had red eyes. Using the DNA Writer translation table , which maps letters and text to codons, they were then able to write out a string of DNA bases with their person’s information. I had them include start and stop codons to demarcate each gene’s location, and put some non-coding DNA in between the genes.
Ravenclaw’s Sequence
TAGGAATTGCATCACGATCTCCTATAGTAGCTATAACTAATCCCACCG TTGGTGTAAACTCATATATGCTATGCATTGTAGACTATCATCTAAATG GATTCGGACCATTCGTTGCACCTATACTAATCAGCATGCATC
Since DNA is made up entirely of only four bases (A, C, T, and G), students could string together a different colored bead for each base to make a physical representation of the DNA strand. To make this a little easier, I adapted the DNA Writer to print out a color representation of the sequences as well. Most of the students used the color bars, but a few preferred to do their beading based off the original sequence only.
Just the beading took about 40 minutes, but the students were remarkable focused on it. Also, based on students’ questions while I was explaining what they had to do, the beading really helped clarify the difference between genes and alleles, and how DNA works.
Each of these DNA strands represents the half-sequence that can be found in a gamete. Next class, we’ll be using our DNA strands to simulate fertilization, mitosis and meiosis. Meiosis, should be most interesting, since it is going to require cutting and splicing the different strands (to simulate changing over), and following the different alleles as four new gametes are produced. This will, in turn, lead into our discussion of heredity.
A Worm Eating Warbler flew into the glass window where the middle school students were taking their annual standardized test. It did not survive.
My students tell me that the same thing happened last year. Now I’m wondering just how often it happens, and if I should start a daily survey.
Curiously, despite their name, these birds rarely eat worms, they prefer insects and spiders.
(Thanks to Scott Woodbury for help with the identification.)
A look into the imaging of large molecules (chromosomes) and the arrangement of atoms in really small particles.
I think that one of the reasons I really like this diagram is because it places the school as a small piece in a much larger ecological context. A student in my Environmental Science class drew it for an assignment. We’d hiked all the way from the creek to the ridge in the company of Scott Woodbury from the Shaw Nature Center, and I asked them to draw a diagram showing the different ecological regions. I’d expected top down maps, which is what almost all the other students did. When I asked why the perspective view, she said just didn’t know how to draw trees from the top down.
One of the articles my students brought to our Environmental Science discussion was about the growing fears about wars over water. Even within the U.S.A. there are significant conflicts, as demonstrated by this NPR article.
Texas has tried to buy Oklahoma water from the state, its cities and towns, and its Native American tribes. But Oklahoma lawmakers have blocked those efforts with a string of laws restricting out-of-state water exports.
The view in Texas is that Oklahoma isn’t even using its full allocation of Red River water. Oklahomans respond that Texas hasn’t gotten serious enough about conservation.
“Our poor, poor thirsty people in Dallas, Texas,” muses state Sen. Jerry Ellis, a Democrat who represents southeastern Oklahoma. “There’s nobody thirsty in Dallas, Texas.”
— Wertz,J., 2013: Thirsty States Take Water Battle To Supreme Court on NPR.
The full article:
P.S. Lauren Markham has an article about environmental “refugees” forced to leave Ethiopia because of the changing rainfall patterns over the last eight years.
While we were talking about what I expect from lab reports, one of my students pointed out the Bibme website. It helps put together bibliography references in a variety of styles: MLA, APA, Chicago, and Turabian.
